2.3 Generalized dynamic programming for multiple sequence alignment [edit]

Until now we worked with alignments between two sequences, but it is likely that you will want to align many sequences at the same time. For example, if you are trying to gain insight on the evolutionary relationships between all of the 16S bacterial genes in a given sample, it would be time consuming and very inefficient to compare them two at a time. It would be more efficient and useful to compare all of the 16S sequences from the bacteria in the same alignment. In the pairwise sequence alignment chapter, we went over dynamic programming algorithms. It's possible to generalize Smith-Waterman and Needleman-Wunsch, the dynamic programming algorithms that we explored for pairwise sequence alignment, to identify the optimal alignment of more than two sequences. Remember that our scoring scheme for pairwise alignment with Smith-Waterman looked like the following:

$$ \begin{align} & F(0, 0) = 0\\ & F(i, 0) = F(i-1, 0) - d\\ & F(0, j) = F(0, j-1) - d\\ \\ & F(i, j) = max \begin{pmatrix} & F(i-1, j-1) + s(c_i, c_j)\\ & F(i-1, j) - d\\ & F(i, j-1) - d)\\ \end{pmatrix} \end{align} $$

To generalize this to three sequences, we could create $3 \times 3$ scoring, dynamic programming, and traceback matrices. Our scoring scheme would then look like the following:

$$ \begin{align} & F(0, 0, 0) = 0\\ & F(i, 0, 0) = F(i-1, 0, 0) - d\\ & F(0, j, 0) = F(0, j-1, 0) - d\\ & F(0, 0, k) = F(0, 0, k-1) - d\\ \\ & F(i, j, k) = max \begin{pmatrix} F(i-1, j-1, k-1) + s(c_i, c_j) + s(c_i, c_k) + s(c_j, c_k)\\ F(i, j-1, k-1) + s(c_j, c_k) - d\\ F(i-1, j, k-1) + s(c_i, c_k) - d\\ F(i-1, j-1, k) + s(c_i, c_j) - d\\ F(i, j, k-1) - 2d\\ F(i, j-1, k) - 2d\\ F(i-1, j, k) - 2d\\ \end{pmatrix} \end{align} $$

However the complexity of this algorithm is much worse than for pairwise alignment. For pairwise alignment, remember that if aligning two sequences of lengths $m$ and $n$, the runtime of the algorithm will be proportional to $m \times n$. If $n$ is longer than or as long as $m$, we simplify the statement to say that the runtime of the algorithm will be be proportional to $n^2$. This curve has a pretty scary trajectory: runtime for pairwise alignment with dynamic programming is said to scale quadratically.

In [1]:
%pylab inline
from __future__ import division, print_function
from functools import partial
from IPython.core import page
page.page = print
Populating the interactive namespace from numpy and matplotlib
In [2]:
import matplotlib.pyplot as plt

seq_lengths = range(25)
s2_times = [t ** 2 for t in range(25)]

plt.plot(range(25), s2_times)
plt.xlabel('Sequence Length')
plt.ylabel('Runtime (s)')
<matplotlib.text.Text at 0x7f8699f58400>

The exponent in the $n^2$ term comes from the fact that, in pairwise alignment, if we assume our sequences are both of length $n$, there are $n \times n$ cells to fill in in the dynamic programming matrix. If we were to generalize either Smith-Waterman or Needleman-Wunsch to three sequences, we would need to create a 3 dimensional array to score and trace back the alignment. For sequences of length $n$, we would therefore have $n \times n \times n$ cells to fill in, and our runtime versus sequence length curve would look like the following.

In [3]:
s3_times = [t ** 3 for t in range(25)]

plt.plot(range(25), s3_times)
plt.xlabel('Sequence Length')
plt.ylabel('Runtime (s)')
<matplotlib.text.Text at 0x7f8699f60550>

That curve looks steeper than the curve for pairwise alignment, and the values on the y-axis are bigger, but it's not really clear how much of a problem this is until we plot runtime for three sequences in the context of the run times for pairwise alignment.

In [4]:
plt.plot(range(25), s2_times)
plt.plot(range(25), s3_times)
plt.xlabel('Sequence Length')
plt.ylabel('Runtime (s)')
<matplotlib.text.Text at 0x7f86c1068668>

And for four sequences:

In [5]:
s4_times = [t ** 4 for t in range(25)]

plt.plot(range(25), s2_times)
plt.plot(range(25), s3_times)
plt.plot(range(25), s4_times)
plt.xlabel('Sequence Length')
plt.ylabel('Runtime (s)')
<matplotlib.text.Text at 0x7f8699de5668>

We clearly have a problem here, and that is that the runtime for multiple sequence alignment using full dynamic programming algorithms grows exponentially with the number of sequences to be aligned. If $n$ is our sequence length, and $s$ is the number of sequences, that means that runtime is proportional to $n^s$. In pairwise alignment, $s$ is always equal to 2, so the problem is more manageable. However, for the general case of $s$ sequences, we really can't even consider Smith-Waterman or Needleman-Wunsch for more than just a few sequences. The pattern in the plots above should illustrate why.

As we explored with database searching, we need to figure out how to align fewer sequences. This is where progressive alignment comes in.

2.3.1 Progressive alignment [edit]

In progressive alignment, the problem of exponential growth of runtime and space is managed by selectively aligning pairs of sequences, and aligning alignments of sequences. What we typically do is identify a pair of closely related sequences, and align those. Then, we identify the next most closely related sequence to that initial pair, and align that sequence to the alignment. This concept of aligning a sequence to an alignment is new, and we'll come back to it in just a few minutes. The other concept of identifying the most closely related sequences, and then the next most closely related sequence, and so on should sound familiar. It effectively means that we're traversing a tree. And herein lies our problem: we need a tree to efficiently align multiple sequences, but we need an alignment to build a good tree.

You probably have two burning questions in your mind right now:

  1. How do we build a tree to guide the alignment process, if we need an alignment to build a good tree?
  2. How do we align a sequence to an alignment, or an alignment to an alignment?

We'll explore both of those through-out the rest of this notebook. First, let's cover the process of progressive multiple sequence alignment, just assuming for a moment that we know how to do both of those things.

The process of progressive multiple sequence alignment could look like the following. First, we start with some sequences and a tree representing the relationship between those sequences. We'll call this our guide tree, because it's going to guide us through the process of multiple sequence alignment. In progressive multiple sequence alignment, we build a multiple sequence alignment for each internal node of the tree, where the alignment at a given internal node contains all of the sequences in the clade defined by that node.

Starting from the root node, descend the bottom branch of the tree until you get to the an internal node. If an alignment hasn't been constructed for that node yet, continue descending the tree until to get to a pair of nodes. In this case, we follow the two branches to the tips. We then align the sequences at that pair of tips (usually with Needleman-Wunsch, for multiple sequence alignment), and assign that alignment to the node connecting those tips.

Next, we want to find what to align the resulting alignment to, so start from the root node and descend the top branch of the tree. When you get to the next node, determine if an alignment has already been created for that node. If not, our job is to build that alignment so we have something to align against. In this case, that means that we need to align s1, s2, and s3. We can achieve this by aligning s1 and s3 first, to get the alignment at the internal node connecting them.

We can next align the alignment of s1 and s3 with s2, to get the alignment at the internal node connecting those clades.

And finally, we can compute the alignment at the root node of the tree, by aligning the alignment of s1, s2, and s3 with the alignment of s4 and s5.

The alignment at the root node is our multiple sequence alignment. Building the guide tree [edit]

Let's address the first of our outstanding questions. I mentioned above that we need an alignment to build a good tree. The key word here is good. We can build a very rough tree - one that we would never want to present as representing the actual relationships between the sequences in question - without first aligning the sequences. Remember that building a UPGMA tree requires only a distance matrix, so if we can find a non-alignment-dependent way to compute distances between the sequences, we can build a rough UPGMA tree from them.

Let's compute distances between the sequences based on their word composition. We'll define a word here as k adjacent characters in the sequence. We can then define a function that will return all of the words in a sequence as follows. These words can be defined as being overlapping, or non-overlapping. We'll go with overlapping for this example, as the more words we have, the better our guide tree should be.

In [6]:
from skbio import DNA
%psource DNA.iter_kmers
    def iter_kmers(self, k, overlap=True):
        """Generate kmers of length `k` from this sequence.

        k : int
            The kmer length.
        overlap : bool, optional
            Defines whether the kmers should be overlapping or not.

            kmer of length `k` contained in this sequence.

            If `k` is less than 1.

        >>> from skbio import Sequence
        >>> s = Sequence('ACACGACGTT')
        >>> for kmer in s.iter_kmers(4, overlap=False):
        ...     str(kmer)
        >>> for kmer in s.iter_kmers(3, overlap=True):
        ...     str(kmer)

        if k < 1:
            raise ValueError("k must be greater than 0.")

        if overlap:
            step = 1
            count = len(self) - k + 1
            step = k
            count = len(self) // k

        if len(self) == 0 or self.has_positional_metadata():
            # Slower path when sequence is empty or positional metadata needs
            # to be sliced.
            for i in range(0, len(self) - k + 1, step):
                yield self[i:i+k]
            # Optimized path when positional metadata doesn't need slicing.
            kmers = np.lib.stride_tricks.as_strided(
                self._bytes, shape=(k, count), strides=(1, step)).T

            metadata = None
            if self.has_metadata():
                metadata = self.metadata

            for s in kmers:
                yield self._constructor(

In [7]:
for e in DNA("ACCGGTGACCAGTTGACCAGTA").iter_kmers(3):
In [8]:
for e in DNA("ACCGGTGACCAGTTGACCAGTA").iter_kmers(7):
In [9]:
for e in DNA("ACCGGTGACCAGTTGACCAGTA").iter_kmers(3, overlap=False):

If we then have two sequences, we can compute the word counts for each and define a distance between the sequences as the fraction of words that are unique to either sequence.

In [10]:
from iab.algorithms import kmer_distance
%psource kmer_distance
def kmer_distance(sequence1, sequence2, k=3, overlap=True):
    """Compute the kmer distance between a pair of sequences

    sequence1 : skbio.Sequence
    sequence2 : skbio.Sequence
    k : int, optional
        The word length.
    overlapping : bool, optional
        Defines whether the k-words should be overlapping or not

        Fraction of the set of k-mers from both sequence1 and
        sequence2 that are unique to either sequence1 or

        If k < 1.

    k-mer counts are not incorporated in this distance metric.

    sequence1_kmers = set(map(str, sequence1.iter_kmers(k, overlap)))
    sequence2_kmers = set(map(str, sequence2.iter_kmers(k, overlap)))
    all_kmers = sequence1_kmers | sequence2_kmers
    shared_kmers = sequence1_kmers & sequence2_kmers
    number_unique = len(all_kmers) - len(shared_kmers)
    fraction_unique = number_unique / len(all_kmers)
    return fraction_unique

We can then use this as a distance function...

In [11]:

print(s1.distance(s2, kmer_distance))
print(s1.distance(s3, kmer_distance))

If we wanted to override the default to create (for example) a 5-mer distance function, we could use functools.partial.

In [12]:
fivemer_distance = partial(kmer_distance, k=5)


print(s1.distance(s2, fivemer_distance))
print(s1.distance(s3, fivemer_distance))

We can now apply one of these functions to build a distance matrix for a set of sequences that we want to align.

In [13]:
query_sequences = [DNA("ACCGGTGACCAGTTGACCAGT", {"id": "s1"}),
                   DNA("ATCGGTACCGGTAGAAGT", {"id": "s2"}),
                   DNA("GGTACCAAATAGAA", {"id": "s3"}),
                   DNA("GGCACCAAACAGAA", {"id": "s4"}),
                   DNA("GGCCCACTGAT", {"id": "s5"})]
In [14]:
from skbio import DistanceMatrix

guide_dm = DistanceMatrix.from_iterable(query_sequences, metric=kmer_distance, key='id')

scikit-bio also has some basic visualization functionality for these objects. For example, we can easily visualize this object as a heatmap.

In [15]:
fig = guide_dm.plot(cmap='Greens')

We can next use some functionality from SciPy to cluster the sequences with UPGMA, and print out a dendrogram.

In [16]:
from scipy.cluster.hierarchy import average, dendrogram, to_tree

for q in query_sequences:

guide_lm = average(guide_dm.condensed_form())
guide_d = dendrogram(guide_lm, labels=guide_dm.ids, orientation='right',
                     link_color_func=lambda x: 'black')
guide_tree = to_tree(guide_lm)
In [17]:
from iab.algorithms import guide_tree_from_sequences
%psource guide_tree_from_sequences
def guide_tree_from_sequences(sequences,
                              display_tree = False):
    """ Build a UPGMA tree by applying metric to sequences

    sequences : list of skbio.Sequence objects (or subclasses)
      The sequences to be represented in the resulting guide tree.
    metric : function
      Function that returns a single distance value when given a pair of
      skbio.Sequence objects.
    display_tree : bool, optional
      Print the tree before returning.


    guide_dm = DistanceMatrix.from_iterable(
                    sequences, metric=metric, key='id')
    guide_lm = sp.cluster.hierarchy.average(guide_dm.condensed_form())
    guide_tree = to_tree(guide_lm)
    if display_tree:
        guide_d = sp.cluster.hierarchy.dendrogram(guide_lm, labels=guide_dm.ids, orientation='right',
               link_color_func=lambda x: 'black')
    return guide_tree

In [18]:
t = guide_tree_from_sequences(query_sequences, display_tree=True)

We now have a guide tree, so we can move on to the next step of progressive alignment. Generalization of Needleman-Wunsch (with affine gap scoring) for progressive multiple sequence alignment [edit]

Next, we'll address our second burning question: aligning alignments. As illustrated above, there are basically three different types of pairwise alignment we need to support for progressive multiple sequence alignment with Needleman-Wunsch. These are:

  1. Alignment of a pair of sequences.
  2. Alignment of a sequence and an alignment.
  3. Alignment of a pair of alignments.

Standard Needleman-Wunsch supports the first, and it is very easy to generalize it to support the latter two. The only change that is necessary is in how the alignment of two non-gap characters is scored. Recall that we previously scored an alignment of two characters by looking up the score of substitution from one to the other in a substitution matrix. To adapt this for aligning a sequence to an alignment, or for aligning an alignment to an alignment, we compute this substitution as the average score of aligning the pairs of characters.

For example, if we want to align the alignment column from $aln1$:


to the alignment column from $aln2$:


we could compute the substitution score using the matrix $m$ as:

$$ s = \frac{m[A][T] + m[A][G] + m[C][T] + m[C][G]}{aln1_{length} \times aln2_{length}} $$

The following code adapts our implementation of Needleman-Wunsch to support aligning a sequence to an alignment, or aligning an alignment to an alignment.

In [19]:
from iab.algorithms import format_dynamic_programming_matrix, format_traceback_matrix
from skbio.alignment._pairwise import _compute_score_and_traceback_matrices

%psource _compute_score_and_traceback_matrices
def _compute_score_and_traceback_matrices(
        aln1, aln2, gap_open_penalty, gap_extend_penalty, substitution_matrix,
        new_alignment_score=-np.inf, init_matrices_f=_init_matrices_nw,
        penalize_terminal_gaps=True, gap_substitution_score=0):
    """Return dynamic programming (score) and traceback matrices.

    A note on the ``penalize_terminal_gaps`` parameter. When this value is
    ``False``, this function is no longer true Smith-Waterman/Needleman-Wunsch
    scoring, but when ``True`` it can result in biologically irrelevant
    artifacts in Needleman-Wunsch (global) alignments. Specifically, if one
    sequence is longer than the other (e.g., if aligning a primer sequence to
    an amplification product, or searching for a gene in a genome) the shorter
    sequence will have a long gap inserted. The parameter is ``True`` by
    default (so that this function computes the score and traceback matrices as
    described by the original authors) but the global alignment wrappers pass
    ``False`` by default, so that the global alignment API returns the result
    that users are most likely to be looking for.

    aln1_length = aln1.shape.position
    aln2_length = aln2.shape.position
    # cache some values for quicker/simpler access
    aend = _traceback_encoding['alignment-end']
    match = _traceback_encoding['match']
    vgap = _traceback_encoding['vertical-gap']
    hgap = _traceback_encoding['horizontal-gap']

    new_alignment_score = (new_alignment_score, aend)

    # Initialize a matrix to use for scoring the alignment and for tracing
    # back the best alignment
    score_matrix, traceback_matrix = init_matrices_f(
        aln1, aln2, gap_open_penalty, gap_extend_penalty)

    # Iterate over the characters in aln2 (which corresponds to the vertical
    # sequence in the matrix)
    for aln2_pos, aln2_chars in enumerate(aln2.iter_positions(
            ignore_metadata=True), 1):
        aln2_chars = str(aln2_chars)

        # Iterate over the characters in aln1 (which corresponds to the
        # horizontal sequence in the matrix)
        for aln1_pos, aln1_chars in enumerate(aln1.iter_positions(
                ignore_metadata=True), 1):
            aln1_chars = str(aln1_chars)

            # compute the score for a match/mismatch
            substitution_score = _compute_substitution_score(
                aln1_chars, aln2_chars, substitution_matrix,
                gap_substitution_score, aln1.dtype.gap_chars)

            diag_score = \
                (score_matrix[aln2_pos-1, aln1_pos-1] + substitution_score,

            # compute the score for adding a gap in aln2 (vertical)
            if not penalize_terminal_gaps and (aln1_pos == aln1_length):
                # we've reached the end of aln1, so adding vertical gaps
                # (which become gaps in aln1) should no longer
                # be penalized (if penalize_terminal_gaps == False)
                up_score = (score_matrix[aln2_pos-1, aln1_pos], vgap)
            elif traceback_matrix[aln2_pos-1, aln1_pos] == vgap:
                # gap extend, because the cell above was also a gap
                up_score = \
                    (score_matrix[aln2_pos-1, aln1_pos] - gap_extend_penalty,
                # gap open, because the cell above was not a gap
                up_score = \
                    (score_matrix[aln2_pos-1, aln1_pos] - gap_open_penalty,

            # compute the score for adding a gap in aln1 (horizontal)
            if not penalize_terminal_gaps and (aln2_pos == aln2_length):
                # we've reached the end of aln2, so adding horizontal gaps
                # (which become gaps in aln2) should no longer
                # be penalized (if penalize_terminal_gaps == False)
                left_score = (score_matrix[aln2_pos, aln1_pos-1], hgap)
            elif traceback_matrix[aln2_pos, aln1_pos-1] == hgap:
                # gap extend, because the cell to the left was also a gap
                left_score = \
                    (score_matrix[aln2_pos, aln1_pos-1] - gap_extend_penalty,
                # gap open, because the cell to the left was not a gap
                left_score = \
                    (score_matrix[aln2_pos, aln1_pos-1] - gap_open_penalty,

            # identify the largest score, and use that information to populate
            # the score and traceback matrices
            best_score = _first_largest([new_alignment_score, left_score,
                                         diag_score, up_score])
            score_matrix[aln2_pos, aln1_pos] = best_score[0]
            traceback_matrix[aln2_pos, aln1_pos] = best_score[1]

    return score_matrix, traceback_matrix

In [20]:
from skbio.alignment._pairwise import _traceback
%psource _traceback
def _traceback(traceback_matrix, score_matrix, aln1, aln2, start_row,
    # cache some values for simpler reference
    aend = _traceback_encoding['alignment-end']
    match = _traceback_encoding['match']
    vgap = _traceback_encoding['vertical-gap']
    hgap = _traceback_encoding['horizontal-gap']
    gap_character = aln1.dtype.default_gap_char

    # initialize the result alignments
    aln1_sequence_count = aln1.shape.sequence
    aligned_seqs1 = [[] for e in range(aln1_sequence_count)]

    aln2_sequence_count = aln2.shape.sequence
    aligned_seqs2 = [[] for e in range(aln2_sequence_count)]

    current_row = start_row
    current_col = start_col

    best_score = score_matrix[current_row, current_col]
    current_value = None

    while current_value != aend:
        current_value = traceback_matrix[current_row, current_col]

        if current_value == match:
            for aligned_seq, input_seq in zip(aligned_seqs1, aln1):
            for aligned_seq, input_seq in zip(aligned_seqs2, aln2):
            current_row -= 1
            current_col -= 1
        elif current_value == vgap:
            for aligned_seq in aligned_seqs1:
            for aligned_seq, input_seq in zip(aligned_seqs2, aln2):
            current_row -= 1
        elif current_value == hgap:
            for aligned_seq, input_seq in zip(aligned_seqs1, aln1):
            for aligned_seq in aligned_seqs2:
            current_col -= 1
        elif current_value == aend:
            raise ValueError(
                "Invalid value in traceback matrix: %s" % current_value)

    for i, (aligned_seq, original) in enumerate(zip(aligned_seqs1, aln1)):
        aligned_seq = ''.join(aligned_seq)[::-1]
        constructor = aln1.dtype
        metadata = None
        if original.has_metadata():
            metadata = original.metadata
        aligned_seqs1[i] = constructor(aligned_seq, metadata=metadata,

    for i, (aligned_seq, original) in enumerate(zip(aligned_seqs2, aln2)):
        aligned_seq = ''.join(aligned_seq)[::-1]
        constructor = aln2.dtype
        metadata = None
        if original.has_metadata():
            metadata = original.metadata
        aligned_seqs2[i] = constructor(aligned_seq, metadata=metadata,

    return aligned_seqs1, aligned_seqs2, best_score, current_col, current_row

In [21]:
from skbio.alignment import global_pairwise_align_nucleotide
%psource global_pairwise_align_nucleotide
def global_pairwise_align_nucleotide(seq1, seq2, gap_open_penalty=5,
                                     match_score=1, mismatch_score=-2,
    """Globally align nucleotide seqs or alignments with Needleman-Wunsch

    seq1 : DNA, RNA, or TabularMSA[DNA|RNA]
        The first unaligned sequence(s).
    seq2 : DNA, RNA, or TabularMSA[DNA|RNA]
        The second unaligned sequence(s).
    gap_open_penalty : int or float, optional
        Penalty for opening a gap (this is substracted from previous best
        alignment score, so is typically positive).
    gap_extend_penalty : int or float, optional
        Penalty for extending a gap (this is substracted from previous best
        alignment score, so is typically positive).
    match_score : int or float, optional
        The score to add for a match between a pair of bases (this is added
        to the previous best alignment score, so is typically positive).
    mismatch_score : int or float, optional
        The score to add for a mismatch between a pair of bases (this is
        added to the previous best alignment score, so is typically
    substitution_matrix: 2D dict (or similar)
        Lookup for substitution scores (these values are added to the
        previous best alignment score). If provided, this overrides
        ``match_score`` and ``mismatch_score``.
    penalize_terminal_gaps: bool, optional
        If True, will continue to penalize gaps even after one sequence has
        been aligned through its end. This behavior is true Needleman-Wunsch
        alignment, but results in (biologically irrelevant) artifacts when
        the sequences being aligned are of different length. This is ``False``
        by default, which is very likely to be the behavior you want in all or
        nearly all cases.

        ``TabularMSA`` object containing the aligned sequences, alignment score
        (float), and start/end positions of each input sequence (iterable
        of two-item tuples). Note that start/end positions are indexes into the
        unaligned sequences.

    See Also

    Default ``match_score``, ``mismatch_score``, ``gap_open_penalty`` and
    ``gap_extend_penalty`` parameters are derived from the NCBI BLAST
    Server [1]_.

    This function can be use to align either a pair of sequences, a pair of
    alignments, or a sequence and an alignment.

    .. [1] http://blast.ncbi.nlm.nih.gov/Blast.cgi

    for seq in seq1, seq2:
        if not isinstance(seq, (DNA, RNA, TabularMSA)):
            raise TypeError(
                "`seq1` and `seq2` must be DNA, RNA, or TabularMSA, not type "
                "%r" % type(seq).__name__)
        if isinstance(seq, TabularMSA) and not issubclass(seq.dtype,
                                                          (DNA, RNA)):
            raise TypeError(
                "`seq1` and `seq2` must be TabularMSA with DNA or RNA dtype, "
                "not dtype %r" % seq.dtype.__name__)

    # use the substitution matrix provided by the user, or compute from
    # match_score and mismatch_score if a substitution matrix was not provided
    if substitution_matrix is None:
        substitution_matrix = \
            make_identity_substitution_matrix(match_score, mismatch_score)

    return global_pairwise_align(seq1, seq2, gap_open_penalty,
                                 gap_extend_penalty, substitution_matrix,

For the sake of the examples below, I'm going to override one of the global_pairwise_align_nucleotide defaults to penalize terminal gaps. This effectively tells the algorithm that we know we have a collection of sequences that are homologous from beginning to end.

In [22]:
global_pairwise_align_nucleotide = partial(global_pairwise_align_nucleotide, penalize_terminal_gaps=True)

For example, we can still use this code to align pairs of sequences (but note that we now need to pass those sequences in as a pair of one-item lists):

In [23]:
aln1, _, _ = global_pairwise_align_nucleotide(query_sequences[0], query_sequences[1])
    sequence count: 2
    position count: 21
/opt/conda/envs/iab/lib/python3.5/site-packages/skbio/alignment/_pairwise.py:599: EfficiencyWarning: You're using skbio's python implementation of Needleman-Wunsch alignment. This is known to be very slow (e.g., thousands of times slower than a native C implementation). We'll be adding a faster version soon (see https://github.com/biocore/scikit-bio/issues/254 to track progress on this).
  "to track progress on this).", EfficiencyWarning)

We can align that alignment to one of our other sequences.

In [24]:
aln1, _, _ = global_pairwise_align_nucleotide(aln1, query_sequences[2])
    sequence count: 3
    position count: 21
/opt/conda/envs/iab/lib/python3.5/site-packages/skbio/alignment/_pairwise.py:599: EfficiencyWarning: You're using skbio's python implementation of Needleman-Wunsch alignment. This is known to be very slow (e.g., thousands of times slower than a native C implementation). We'll be adding a faster version soon (see https://github.com/biocore/scikit-bio/issues/254 to track progress on this).
  "to track progress on this).", EfficiencyWarning)

Alternatively, we can align another pair of sequences:

In [25]:
aln2, _, _ = global_pairwise_align_nucleotide(query_sequences[2], query_sequences[3])
    sequence count: 2
    position count: 14
/opt/conda/envs/iab/lib/python3.5/site-packages/skbio/alignment/_pairwise.py:599: EfficiencyWarning: You're using skbio's python implementation of Needleman-Wunsch alignment. This is known to be very slow (e.g., thousands of times slower than a native C implementation). We'll be adding a faster version soon (see https://github.com/biocore/scikit-bio/issues/254 to track progress on this).
  "to track progress on this).", EfficiencyWarning)

And then align that alignment against our previous alignment:

In [26]:
aln3, _, _  = global_pairwise_align_nucleotide(aln1, aln2)
    sequence count: 5
    position count: 21
/opt/conda/envs/iab/lib/python3.5/site-packages/skbio/alignment/_pairwise.py:599: EfficiencyWarning: You're using skbio's python implementation of Needleman-Wunsch alignment. This is known to be very slow (e.g., thousands of times slower than a native C implementation). We'll be adding a faster version soon (see https://github.com/biocore/scikit-bio/issues/254 to track progress on this).
  "to track progress on this).", EfficiencyWarning) Putting it all together: progressive multiple sequence alignment [edit]

We can now combine all of these steps to take a set of query sequences, build a guide tree, perform progressive multiple sequence alignment, and return the guide tree (as a SciPy linkage matrix) and the alignment.

In [27]:
from skbio import TreeNode
guide_tree = TreeNode.from_linkage_matrix(guide_lm, guide_dm.ids)

We can view the guide tree in Newick format as follows:

In [28]:

In [29]:
from iab.algorithms import progressive_msa
%psource progressive_msa
def progressive_msa(sequences, pairwise_aligner, guide_tree=None,
    """ Perform progressive msa of sequences

    sequences : skbio.SequenceCollection
        The sequences to be aligned.
    metric : function, optional
      Function that returns a single distance value when given a pair of
      skbio.Sequence objects. This will be used to build a guide tree if one
      is not provided.
    guide_tree : skbio.TreeNode, optional
        The tree that should be used to guide the alignment process.
    pairwise_aligner : function
        Function that should be used to perform the pairwise alignments,
        for example skbio.alignment.global_pairwise_align_nucleotide. Must
        support skbio.Sequence objects or skbio.TabularMSA objects
        as input.



    if guide_tree is None:
        guide_dm = DistanceMatrix.from_iterable(
                        sequences, metric=metric, key='id')
        guide_lm = sp.cluster.hierarchy.average(guide_dm.condensed_form())
        guide_tree = TreeNode.from_linkage_matrix(guide_lm, guide_dm.ids)

    seq_lookup = {s.metadata['id']: s for i, s in enumerate(sequences)}
    c1, c2 = guide_tree.children
    if c1.is_tip():
        c1_aln = seq_lookup[c1.name]
        c1_aln = progressive_msa(sequences, pairwise_aligner, c1)

    if c2.is_tip():
        c2_aln = seq_lookup[c2.name]
        c2_aln = progressive_msa(sequences, pairwise_aligner, c2)

    alignment, _, _ = pairwise_aligner(c1_aln, c2_aln)
    # this is a temporary hack as the aligners in skbio 0.4.1 are dropping
    # metadata - this makes sure that the right metadata is associated with
    # the sequence after alignment
    if isinstance(c1_aln, Sequence):
        alignment[0].metadata = c1_aln.metadata
        len_c1_aln = 1
        for i in range(len(c1_aln)):
            alignment[i].metadata = c1_aln[i].metadata
        len_c1_aln = len(c1_aln)
    if isinstance(c2_aln, Sequence):
        alignment[1].metadata = c2_aln.metadata
        for i in range(len(c2_aln)):
            alignment[len_c1_aln + i].metadata = c2_aln[i].metadata

    return alignment

In [30]:
msa = progressive_msa(query_sequences, pairwise_aligner=global_pairwise_align_nucleotide, guide_tree=guide_tree)
/opt/conda/envs/iab/lib/python3.5/site-packages/skbio/alignment/_pairwise.py:599: EfficiencyWarning: You're using skbio's python implementation of Needleman-Wunsch alignment. This is known to be very slow (e.g., thousands of times slower than a native C implementation). We'll be adding a faster version soon (see https://github.com/biocore/scikit-bio/issues/254 to track progress on this).
  "to track progress on this).", EfficiencyWarning)
    sequence count: 5
    position count: 21

We can now build a (hopefully) improved tree from our multiple sequence alignment. First we'll look at our original distance matrix again, and then the distance matrix generated from the progressive multiple sequence alignment.

In [31]:
fig = guide_dm.plot(cmap='Greens')
In [32]:
msa_dm = DistanceMatrix.from_iterable(msa, metric=kmer_distance)
fig = msa_dm.plot(cmap='Greens')

The UPGMA trees that result from these alignments are very different. First we'll look at the guide tree, and then the tree resulting from the progressive multiple sequence alignment.

In [33]:
d = dendrogram(guide_lm, labels=guide_dm.ids, orientation='right',
               link_color_func=lambda x: 'black')
In [34]:
msa_lm = average(msa_dm.condensed_form())
d = dendrogram(msa_lm, labels=msa_dm.ids, orientation='right',
               link_color_func=lambda x: 'black')

And we can wrap this all up in a single convenience function:

In [35]:
from iab.algorithms import progressive_msa_and_tree
%psource progressive_msa_and_tree
def progressive_msa_and_tree(sequences,
    """ Perform progressive msa of sequences and build a UPGMA tree
    sequences : skbio.SequenceCollection
        The sequences to be aligned.
    pairwise_aligner : function
        Function that should be used to perform the pairwise alignments,
        for example skbio.alignment.global_pairwise_align_nucleotide. Must
        support skbio.Sequence objects or skbio.TabularMSA objects
        as input.
    metric : function, optional
      Function that returns a single distance value when given a pair of
      skbio.Sequence objects. This will be used to build a guide tree if one
      is not provided.
    guide_tree : skbio.TreeNode, optional
        The tree that should be used to guide the alignment process.
    display_aln : bool, optional
        Print the alignment before returning.
    display_tree : bool, optional
        Print the tree before returning.


    msa = progressive_msa(sequences, pairwise_aligner=pairwise_aligner,

    if display_aln:

    msa_dm = DistanceMatrix.from_iterable(msa, metric=metric, key='id')
    msa_lm = sp.cluster.hierarchy.average(msa_dm.condensed_form())
    msa_tree = TreeNode.from_linkage_matrix(msa_lm, msa_dm.ids)
    if display_tree:
        print("\nOutput tree:")
        d = sp.cluster.hierarchy.dendrogram(msa_lm, labels=msa_dm.ids, orientation='right',
                   link_color_func=lambda x: 'black')
    return msa, msa_tree

In [36]:
msa = progressive_msa(query_sequences, pairwise_aligner=global_pairwise_align_nucleotide, guide_tree=guide_tree)
/opt/conda/envs/iab/lib/python3.5/site-packages/skbio/alignment/_pairwise.py:599: EfficiencyWarning: You're using skbio's python implementation of Needleman-Wunsch alignment. This is known to be very slow (e.g., thousands of times slower than a native C implementation). We'll be adding a faster version soon (see https://github.com/biocore/scikit-bio/issues/254 to track progress on this).
  "to track progress on this).", EfficiencyWarning)
In [37]:
msa, tree = progressive_msa_and_tree(query_sequences, pairwise_aligner=global_pairwise_align_nucleotide,
                                     display_tree=True, display_aln=True)
/opt/conda/envs/iab/lib/python3.5/site-packages/skbio/alignment/_pairwise.py:599: EfficiencyWarning: You're using skbio's python implementation of Needleman-Wunsch alignment. This is known to be very slow (e.g., thousands of times slower than a native C implementation). We'll be adding a faster version soon (see https://github.com/biocore/scikit-bio/issues/254 to track progress on this).
  "to track progress on this).", EfficiencyWarning)
    sequence count: 5
    position count: 21

Output tree:

2.3.2 Progressive alignment versus iterative alignment [edit]

In an iterative alignment, the output tree from the above progressive alignment is used as a guide tree, and the full process repeated. This is performed to reduce errors that result from a low-quality guide tree.

In [38]:
from iab.algorithms import iterative_msa_and_tree
%psource iterative_msa_and_tree
def iterative_msa_and_tree(sequences,
    """ Perform progressive msa of sequences and build a UPGMA tree
    sequences : skbio.SequenceCollection
       The sequences to be aligned.
    num_iterations : int
       The number of iterations of progressive multiple sequence alignment to
       perform. Must be greater than zero and less than five.
    pairwise_aligner : function
       Function that should be used to perform the pairwise alignments,
       for example skbio.alignment.global_pairwise_align_nucleotide. Must
       support skbio.Sequence objects or skbio.TabularMSA objects
       as input.
    metric : function, optional
      Function that returns a single distance value when given a pair of
      skbio.Sequence objects. This will be used to build a guide tree if one
      is not provided.
    display_aln : bool, optional
       Print the alignment before returning.
    display_tree : bool, optional
       Print the tree before returning.


    if num_iterations > 5:
        raise ValueError("A maximum of five iterations is allowed."
                         "You requested %d." % num_iterations)
    previous_iter_tree = None
    for i in range(num_iterations):
        if i == (num_iterations - 1):
            # only display the last iteration
            display = True
            display = False
        previous_iter_msa, previous_iter_tree = \
             display_aln=display_aln and display,
             display_tree=display_tree and display)

    return previous_iter_msa, previous_iter_tree

In [39]:
msa, tree = iterative_msa_and_tree(query_sequences, pairwise_aligner=global_pairwise_align_nucleotide, num_iterations=1, display_aln=True, display_tree=True)
    sequence count: 5
    position count: 21

Output tree:
/opt/conda/envs/iab/lib/python3.5/site-packages/skbio/alignment/_pairwise.py:599: EfficiencyWarning: You're using skbio's python implementation of Needleman-Wunsch alignment. This is known to be very slow (e.g., thousands of times slower than a native C implementation). We'll be adding a faster version soon (see https://github.com/biocore/scikit-bio/issues/254 to track progress on this).
  "to track progress on this).", EfficiencyWarning)
In [40]:
msa, tree = iterative_msa_and_tree(query_sequences, pairwise_aligner=global_pairwise_align_nucleotide, num_iterations=2, display_aln=True, display_tree=True)
/opt/conda/envs/iab/lib/python3.5/site-packages/skbio/alignment/_pairwise.py:599: EfficiencyWarning: You're using skbio's python implementation of Needleman-Wunsch alignment. This is known to be very slow (e.g., thousands of times slower than a native C implementation). We'll be adding a faster version soon (see https://github.com/biocore/scikit-bio/issues/254 to track progress on this).
  "to track progress on this).", EfficiencyWarning)
    sequence count: 5
    position count: 21

Output tree:
In [41]:
msa, tree = iterative_msa_and_tree(query_sequences, pairwise_aligner=global_pairwise_align_nucleotide, num_iterations=3, display_aln=True, display_tree=True)
/opt/conda/envs/iab/lib/python3.5/site-packages/skbio/alignment/_pairwise.py:599: EfficiencyWarning: You're using skbio's python implementation of Needleman-Wunsch alignment. This is known to be very slow (e.g., thousands of times slower than a native C implementation). We'll be adding a faster version soon (see https://github.com/biocore/scikit-bio/issues/254 to track progress on this).
  "to track progress on this).", EfficiencyWarning)
    sequence count: 5
    position count: 21

Output tree:
In [42]:
msa, tree = iterative_msa_and_tree(query_sequences, pairwise_aligner=global_pairwise_align_nucleotide, num_iterations=5, display_aln=True, display_tree=True)
/opt/conda/envs/iab/lib/python3.5/site-packages/skbio/alignment/_pairwise.py:599: EfficiencyWarning: You're using skbio's python implementation of Needleman-Wunsch alignment. This is known to be very slow (e.g., thousands of times slower than a native C implementation). We'll be adding a faster version soon (see https://github.com/biocore/scikit-bio/issues/254 to track progress on this).
  "to track progress on this).", EfficiencyWarning)
    sequence count: 5
    position count: 21

Output tree:

Some references that I used in assembling these notes include 1, 2, 3, 4, and 5.